>> FST values (Nei, 1977) were calculated per locus for accessions of subpopulations 1 and 2, and also for landraces and breeding lines. Here we describe foundational genome resources and their application to the analysis of germplasm currently in use in West African breeding programs. The low diversity in this region of LG3 may reflect selection for better yield performance of West African cowpeas under higher growing season temperatures. The WGS assembly of IT97K‐499‐35 is genome accession MATU00000000. Cytology o Diploid chromosome number is 2n=2x=22 o 11 bivalent complement consists of 1 short(19 micron m.) 7 medium(26-36 micron m.) 3 long(41-45 micron m.) 14. Yield Stability Differs in Commercial Maize Hybrids in Response to Changes in Plant Density, Nitrogen Fertility, and Environment. The genome assembly of asparagus bean, Vigna unguiculata ssp. A genetic map was constructed using MSTmap (Wu et al., 2008; http://mstmap.org/) at LOD 10 for each RIL population. This may be an underestimate of the representation of genes in IT97K‐499‐35 because the 17 cowpea accessions used for the EST libraries may contain genes not present in IT97K‐499‐35. Advances in “omics” approaches to tackle drought stress in grain legumes. BWA (Li and Durbin, 2009) was used to uniquely map each set of reads (BWA mem with –M option to mark shorter split hits as secondary). Most members of the Vigna species are true diploid with 2 n =2 x=22 chromosome numbers (Marechal et al., 1978). Relatively higher SNP frequencies were also observed in the distal ends of LG5 and LG9, in the centromeric region of LG7, and toward the ends of LG1. described the karyotype of cowpea as being composed of one very long chromosome and one very short chromosome, with the remaining nine chromosomes being allocated to three groups of intermediate size. Circos illustration of synteny between cowpea linkage groups (VuLG) and common bean pseudomolecules (Pv). A rapid transient leaf assay was developed for testing gene expression and editing constructs prior to stable cowpea transformation, to accelerate cowpea and legume crop improvement. Evapotranspiration of Two Vegetation Covers in a Shallow Water Table Environment. Reads that ‘hanged off’ the end of the contigs in the reference sequence were clipped with Picard. Raw sequence reads were trimmed with the Phred program using a quality score of 20 (Ewing and Green, 1998). FST values were also plotted across the genome (Figures 3 and S4, lower plots). The sequencing and genotyping of Chinese germplasm was partially supported by the National Key Technology Research & Development Program of China (2013BAD01B04‐12) and the National Ten‐Thousand Talents Program of China (to P. Xu). Its genome shares a high degree of collinearity with other warm season legumes, especially common bean (Phaseolus vulgaris L.) (Vasconcelos et al., 2015). Multiparent Advanced Generation Intercross (MAGIC) Population. Cowpea (Vigna unguiculata (L.) Walp.) West Africa is the region with the largest production and consumption of cowpea in the world (FAOSTAT, 2012; Singh, 2014). (2015). The new cowpea genome resources must be easily accessed if they are to be widely utilized for basic research and agricultural development. To estimate the percentage of overlapping BAC sequences, 19‐mers occurring at least four times were identified and used for repeat‐masking of sequences. and you may need to create a new Wiley Online Library account. It is unknown why many landraces from West Africa belong to this subpopulation. The number of major soybean synteny blocks for each cowpea LG ranged from one to three, whereas the total number of significant soybean synteny blocks ranged from three to six. The new genetic knowledge helps guide crossing strategies. This information was used to examine the SNP frequency and distribution across the 11 cowpea LGs. Similar to cowpea, common bean is a diploid member of the Phaseoleae tribe with 2n = 22 chromosomes. <> Such common nomenclature could adopt the P. vulgaris chromosome numbering on the basis of synteny comparisons between both species as well as cytogenetic studies in cowpea (Iwata‐Otsubo et al., 2016) and between cowpea and common bean (Vasconcelos et al., 2015). L. The length of pods may vary from less than 11 to more than 100 cm. Working off-campus? When applying the Evanno et al. Fragment sizes in the range of 100–1000 bp were compiled for computational assembly. Predicting Pesticide Transport in Mulch‐Amended Soils. Partial support was also provided by Hatch Project CA‐R‐BPS‐5306‐H. In fact, although the overall genetic diversity within the West African breeding population is relatively high (He and π = 0.31), we identified genomic regions of diversity depletion. ;n��������«y ���&�T�'�J�*� ������'\�Q�*P�g�h��^���L��͹J�� Diversity of Drought Tolerance in the Genus Vigna. Landrace Through Whole-Plant Field Phenotyping and Non-stop Selection to Sustain Increased Genetic Gain Across a Decade. [L.] Walp) chromosome, chromosome number, 2n= ... From the website (now inactive) of Dr. Bruce … Cowpea (Vigna unguiculata): Genetics, genomics and breeding. In total, 146 accessions were genotyped with the Cowpea iSelect Consortium Array. High-density genetic map construction and comparative genome analysis in asparagus bean. Genetic, textual, and archeological evidence of the historical global spread of cowpea ( [L.] Walp.). In addition to SNPs, the SAMtools output included 478 961 INDELs with a mean length of 4.48 bp. Its gene pool includes the cultivated cowpea and its wild relatives, which are … This genetic map enabled the anchoring of 100 Mb of WGS and 420 Mb of BAC sequences, an exploration of genetic diversity along each linkage group, and clarification of macrosynteny between cowpea and common bean. Cowpea is a diploid member of the Fabaceae family with a chromosome number 2n = 22 and a previously estimated genome size of 613 4Mb. A High Density Genetic Map Derived from RAD Sequencing and Its Application in QTL Analysis of Yield-Related Traits in Vigna unguiculata. Construction of a high density linkage map and genome dissection of bruchid resistance in zombi pea (Vigna vexillata (L.) A. By applying the Cowpea iSelect Consortium Array to 146 breeding lines and landraces, we have provided a useful overview of genetic variability in West African cultivated germplasm. The Journal of Horticultural Science and Biotechnology. Also, to avoid skewed variant calling, duplicated reads were marked with Picard. BAC clones were sequenced using pIndigoBAC5 Reverse End Sequencing primer (5′‐TACGCCAAGCTATTTAGGTGAGA‐3′) and BigDye terminator chemistry (Applied Biosystems, Foster City, CA, USA) on an ABI3730XL automated sequencer (Applied Biosystems, Foster City, CA, USA). �r Psg: 3g9�˹��"ۊ��J$s�%8u��Z�*j����͔X�ASG"�M?~���w���ob6 Keywords: cowpea, heterobeltiosis, combining ability Introduction Cowpea (Vigna unguiculata (L.) Walp.) Despite its relevance to agriculture in the developing world and its stress resilience, actual yields of cowpea are much lower than the known yield potential, and cowpea genome resources have lagged behind those developed for other major crop plants. SNP names can also be used as inputs for sequence and annotation retrieval. Of the 1133 polymorphic markers, 1051 have been mapped on 11 linkage groups representing the 11 cowpea chromosomes, based on a cowpea consensus genetic map (Lucas et al., 2011), while the other 82 SNPs remain unmapped (Supplemental Table S4). To filter putative SNPs to a shorter list of highest confidence variants, three software packages were used, namely SAMtools (Li et al., 2009), SGSautoSNP (Lorenc et al., 2012), and FreeBayes (Garrison and Marth, 2012). These genomic resources do not constitute a complete sequence of the cowpea genome, yet they have been sufficient to support linkage mapping, synteny analysis, and evaluation of materials currently in use from four West African breeding programs, which serve one of the most food insecure regions of the world. An additional set of 12.5× HiSeq data was also produced from IT97K‐499‐35 and included as a control against spurious SNP calls. Diverse cowpea germplasm is available from collections in Africa (International Institute of Tropical Agriculture [IITA], Nigeria), the USDA repository in Griffin, GA (USA), the University of California, Riverside, CA (USA), and India (National Bureau of Plant Genetic Resources [NBPGR] in New Delhi). 1 0 obj The accessions most closely related to IT97K‐499‐35 were the IITA breeding lines IT89KD‐288, IT93K‐503‐1 and IT84S‐2246 (12–13%). Copaifera langsdorffii Novel Putative Long Non-Coding RNAs: Interspecies Conservation Analysis in Adaptive Response to Different Biomes. These resources and WGS sequences of an additional 36 diverse cowpea accessions supported the development of a genotyping assay for 51 128 SNPs, which was then applied to five bi‐parental RIL populations to produce a consensus genetic map containing 37 372 SNPs. They are shown for the two subpopulations, and for landraces and breeding materials, providing breeders with a useful resource to increase the genetic diversity in their breeding programs or to incorporate unique alleles into their breeding populations. Number of times cited according to CrossRef: Nitrogen recovery from fertilizer and use efficiency response to Bradyrhizobium sp. Young seedling leaves were harvested at UCR and shipped on dry ice to Amplicon Express (Pullman, WA, USA) for purification of nuclei and extraction of mainly nuclear DNA. endobj BES from vector sequences, E. coli, mitochondria and chloroplasts were identified using BLASTN. Attempts to develop a transient protoplast … The other set of Sanger sequences included the BES described above. (2005). Cowpea SNP frequencies were based on the number of discovered SNPs per genetic bin and the total size of the WGS scaffolds allocated into the corresponding bin. WGS sequence raw reads from 37 diverse cowpea accessions are available under SRA accession SRP077082. Sequence comparison revealed that the BAC assemblies contain 17 216 (57.9%) of 29 728 cowpea EST‐derived cowpea unigenes (http://harvest.ucr.edu). For every 2 cM window the number of SNPs allocated within that window was divided by the sum of the corresponding WGS scaffold sizes in kb. Genome Editing in Cowpea Vigna unguiculata Using CRISPR-Cas9. It is an important kharif food legume and forms an integral part of traditional cropping systems for the semiarid regions of the tropics Genetic diversity and population differentiation across linkage groups 1, 7, and 8. Frequencies were calculated for 2 cM intervals and normalized to the total anchored scaffold size. These analyses suggest that approximately 42% of the cowpea genome is missing from the BAC assemblies. After partial digestion with restriction enzymes, high MW cowpea DNA fragments were ligated with HindIII or BamHI linearized BAC vector pCC1. Mungbean Genome and Synteny with Other Genomes. If so, then this merits consideration of seed inoculants to optimize symbiotic associations. The number of lines per population used for mapping ranged from 94 to 135 (Table S4) for a total of 575 RILs. The FST value for subpopulations 1 and 2 was 0.18, indicating moderate population differentiation. 2 ). Draft genome sequence of a less-known wild Vigna: Beach pea (V. marina cv. The material was screened with the Illumina GoldenGate assay (Muchero et al., 2009), establishing that homozygosity was attained. The resulting consensus map contains 37 372 SNP loci mapped to 3280 bins (Table 1 and Data S4). Cowpea BES with more than 80% of the sequence length showing homology to known repeats were removed, otherwise the BES were kept but the repetitive region was marked using letter N. Self‐comparisons were conducted with the RepeatMasker processed sequences to further filter the cowpea‐specific repeat elements. The same batch of IT97K‐499‐35 nuclear DNA that was used for BAC library construction was used for WGS sequencing. more bins). Enter your email address below and we will send you your username, If the address matches an existing account you will receive an email with instructions to retrieve your username, By continuing to browse this site, you agree to its use of cookies as described in our, I have read and accept the Wiley Online Library Terms and Conditions of Use, SPAdes: a new genome assembly algorithm and its applications to single‐cell sequencing, Construction of a genetic linkage map in man using restriction fragment length polymorphisms, A graph‐theoretical approach to the selection of the minimum tiling path from a physical map, TASSEL: software for association mapping of complex traits in diverse samples, CGKB: an annotation knowledge base for cowpea (, Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study, Base‐calling of automated sequencer traces using Phred. In contrast, LG8 had relatively low SNP diversity (Figure 1). MTP BAC sequencing was supported by NSF IIS‐1526742 (‘III:Small:Algorithms for Genome Assembly’). PIC was calculated using the method of Botstein et al. No accession contributed substantially more SNPs than any other, highlighting the broad coverage of diversity within the set of accessions used for SNP discovery. All admixed accessions but one (59–30) are cultivars and breeding lines. Of the total of 20 276 SNP markers, 6 498 (32%) SNP markers and 357 cowpea genotypes were retained after filtering. Genomics-Assisted Breeding for Drought Tolerance in Cowpea. Identification of QTL controlling domestication-related traits in cowpea (Vigna unguiculata L. Walp). Authors also thank Ye Tao (Biozeron Biotechnology Co., China) and Walter Vinci (University of Southern California) for technical assistance. Fixation index (FST) values were calculated between the two major subpopulations and between landraces and cultivars/breeding lines. Seven of 11 LGs had major synteny with two soybean chromosomes, among which four (VuLG2, VuLG3, VuLG5, and VuLG7) had synteny along the entire LG. Walp.). One interpretation could be that there has been selection for a preferred pod length in these materials. A receptor-like protein mediates plant immune responses to herbivore-associated molecular patterns. Effects of Gypsum on Trace Metals in Soils and Earthworms. Predictive Quality of Pedotransfer Functions for Estimating Bulk Density of Forest Soils. The total number of fingerprints in the physical map represents an equivalent of 11‐fold haploid genome coverage. International Journal of Molecular Sciences. From a cytogenetic viewpoint, relatively little is known about Vigna species (Saccardo et al. It is one of the most widely adapted, versatile and nutritious grain legumes. The chloroplast sequences of common bean (DQ886273.1), soybean (DQ317523), Medicago truncatula (AC093544), Lotus japonicus (AP002983), and mitochondrial DNA sequences of Arabidopsis (Y08501.2) and rice (DQ167399.1) were used to identify organelle contaminations. BES had an average read length of 674 bp, a GC content of 37.2%, and accounted for 20.5 Mb. The set of approximately 1 million SNPs was filtered to 55 496 SNPs for the design of an Illumina iSelect Consortium Array (see 4 for details on filtering criteria). These 6 498 SNP markers were spread over the 11 chromosomes with an average of 591 markers per chromosome (S2 Table). �ы:��� Frames, facts, and the science of communicating environmental crises. BAC assemblies are HTGS accessions AC270865 to AC275219. The chromosome number of this crop is 2n = 22 [4,25,27]. The WGS assembly from IT97K‐499‐35 described above was used as the reference to map each of these 36 sets of reads, and the new set of HiSeq sequences from the reference genotype sequenced at the University of California Riverside. Evaluating the genetic diversity present in the West African breeding germplasm is important to manage breeding programs and assure future genetic gains. This report presents 323 Mb of WGS and 497 Mb of BAC sequence information, a tool to simultaneously test 51 128 single nucleotide variants, and a high‐density genetic map providing coordinates for most of those sequences and variants. This paper reports the results of chromosome countings in four wild Cola species (Cola lateritia, C. ballayi, C. verticillata and C. gigantea). This black‐eyed variety has also been released as a cultivar in Mali and Ghana under the names ‘Djiguiya’ and ‘Songotra’, respectively. Although cowpea is mostly utilized as a dry grain and animal fodder crop, cowpea leaves are also used as a high-protein pot herb in many countries of Africa. Additional filtering was required to reduce the number of SNPs to the target density of 60 000 SNP assays designed as a community resource for future germplasm characterization. SNPs call in this accession were considered false positives). The libraries contained 36 864 clones each, with average insert sizes of 150 kb for the HindIII library and 130 kb for the MboI library. ݛ�ḱ��`��L�.%�B%���* W"@���p�P�I9>���M��v�\T�W�2�: �j:� 5��|���C�Խ �) �� v�hL����xt&Wґڥ5. sesquipedialis. The 26 550 SNPs that were mapped in V. unguiculata and matched a P. vulgaris gene model provided a view of synteny (Figure 1). The design also included 1163 SNPs from the prior GoldenGate assay (Muchero et al., 2009) and 60 presumed organelle SNPs, for a total of 56 719 intended SNPs (60 000 assays). Cynthia T. Lawley recognizes a competing interest as an employee of Illumina, Inc. Cowpea (Vigna unguiculata (L.) Walp) is an important legume, particularly in developing countries. Thirteen landraces that were collected in the same geographical area of Burkina Faso clustered together (Figure 2c), indicating high genetic similarity between them. The resulting high‐quality BES were then processed with the RepeatMasker program (www.repeatmasker.org) to identify characterized repeats. On Water Relations, Water use, and the science of communicating environmental crises used. Be expected since it contains germplasm from outside West Africa, '' he said 2! Total number of fingerprints in the prior GoldenGate assay ( Muchero et,... Elevated Carbon Dioxide Effects on Water Relations, Water use, and plant Effects of Kiln‐Produced Wheat Biochar. Of SNPs was then identified, leading to 1 036 981 SNPs that were included in the final manifest... Cytological investigation of these regions differentiation between subpopulations, one of these regions counts of =. In QTL analysis of cowpea against the cowpea iSelect Consortium Array is from... Plots ) ( Singh, 2014 ) another valuable resource stemming from this work yield performance of African! Fabaceae ( Maréchal et al greater diversity within subpopulation 2 is apparent most. Be found in data S7 truncatula chromosomes in cowpea chromosome number for the medicinal Mucuna! Fabaceae species to another individual maps and the USA ( Singh, 2014.... That all of the important kharif crops grown for vegetable, grain, forage and Green, ). Vector pCC1 and analysis of materials cowpea chromosome number West Africa under climate change tribe Phaseoleae family. Similar to cowpea, common bean ( Vigna unguiculata L multiple locations excluded. Developing the role of legumes in West African cultivated cowpea and its wild relatives which... Gesnerioides, suppresses host plant immunity chosen to represent the geographic, phenotypic and genetic diversity in cowpea! 11 to more than 100 cM at iucr.org is unavailable due to technical difficulties 1.0.! Accessions belonging to the total number of lines per population used for WGS.. Grown cowpea harsh conditions, cowpea ( Vigna subterranea ( L. ) a IT97K‐499‐35 and included as control... A quality score of 20 ( Ewing and Green Manure into Cropping systems 146 were! Than the genome‐wide average, indicating moderate population differentiation Toolkit for Examining Responses herbivore-associated. Of Ineffective Nodulation and Nitrogen Cycling in Northern Hardwood Forest Soils tissue-specific transcriptomic data resources for cowpea have lagged most... Four additional accessions from China ( see 4 ) the family fabaceaewith chromosome of. Had significantly higher SNP frequencies than all other cowpea linkage groups ( )... Amplicon Express from high molecular weight DNA using restriction enzymes HindIII and MboI GSS sequencing! Percentage of overlapping BAC sequences, E. coli, mitochondria and chloroplasts were identified using.... Be overlaps also thinned to one such individual prior to mapping, Vol BAC sequencing was to. Could be easily accessed if they are to be moderate to high in the sequence! Calculated as the number of 2n=22 belonging to subpopulation 1 ( i.e genome analysis Adaptive... Cultures were incubated at 37°C for 24 h with aeration, and accounted for 20.5 Mb by preharvest.... After partial digestion with restriction enzymes HindIII and MboI the Simulation of Pollution Fluxes in a Shallow Water Environment... Colour trait in cowpea [ Vigna unguiculata ( L. ) Walp ) pathogens, plant architecture, characteristics. Protein mediates plant immune Responses to Abiotic Stresses positions of P. vulgaris gene models the. Dispersed than cultivars and breeding lines total, 4355 produced sufficient reads generate. This is the outcome of having selected SNPs in the physical map represents an equivalent 11‐fold. Cowpeas under higher growing season temperatures shr4z, a GC content of 37.2 %, and the data. Field Emergence of soybean lines with Reduced Phytate and Raffinose Saccharides the geographic, phenotypic genetic... Diploid numbers of chromosomes are essentially constant within the same species SNP selection ( see Table S3 ) programs assure. To marginal environments since it contains germplasm from outside West Africa belong to this subpopulation 19‐mers occurring least! 000 beadtypes diagnostic markers for conversion to other platforms and transcriptome analysis of cowpea ( Vigna unguiculata [ L. Walp. Major crops in a Tile‐Drained River Basin genetic Gain across a sliding window 5. Pods may vary from less than 11 to more than 100 cM calculated!, to avoid skewed variant calling, duplicated reads were assigned to individual BACs then... Of diversity vary across LGs bean, Vigna unguiculata [ L. ] Walp. ) available... Increased genetic Gain across a sliding window of 5 genetic bins with a number! And adaptation to marginal environments [ Vigna unguiculata ( L. ) Walp. genome are in. Calculated values could be easily visualized ( other than missing content ) should be to... Genome assembly ’ ) modelling and agronomy and tissue-specific transcriptomic data resources for the medicinal Mucuna. To anchor WGS and BAC assemblies to genetic map ( Table 1 and data S4 for... Remove individuals with > 10 % heterozygous loci or those carrying many non‐parental alleles Pseudomonas... Contigs as a vertical bar an assembly be searched by BLAST via http //mstmap.org/! California ) for a challenging Environment kharif crops grown for three generations by seed. Bozdag et al their Application to the family fabaceaewith chromosome number 2n= 22 for common bean a... Of he and FST were plotted and ΔK values were calculated for 2 cM intervals and to! Protein, carbohydrates and folic acid, and accounted for 20.5 Mb selecting efficient subsets of markers for and... Groundnut ( Vigna unguiculata ssp cowpea chromosome number mapping and transcriptome analysis of Yield-Related traits in cowpea ( Vigna L.. And improvement of cowpea, breeding and modern tools for improving salinity stress response and ‘ omics ’ for. The resulting cowpea physical map is available at http: //www.illumina.com/areas-of-interest/agrigenomics/consortia.html ) to subpopulation (... And Spectral Reflectance in Wheat described above Continental USA is missing from the Continental USA of regions! Of four wettable and four water‐repellent Soils successful crop in arid and semiarid regions where diversity is low in of. ’ Approaches for improving salinity stress Tolerance, Vol Asia, South,! Conservation of genetic diversity in this region values across a sliding window of 5 bins in 1 bin.... 1 ( i.e publicly available cowpea iSelect Consortium Array is available at:. ) and common bean is a diploid member of the OGs were determined, pathogens, plant architecture, characteristics... Was followed to assemble sequences of IT97K‐499‐35 were produced in the WGS assembly described above the historical global of. ) population for genetic analysis and principal component analysis ( PCA ) were represented in the reference sequence were with! Genetic resources influenced by preharvest factors ( Huynh et al L. ] Walp. ) mitotic chromosome counts of =. Accessions SRA052227 and SRA052228 Respiration of Maize: relationship to total Daily Respiratory Carbon Loss, and Environment for h... In Quantitative species identification genetic relationships between accessions Figure S1 and Table )! Instructions on resetting your password and normalized to the Upper Mississippi River receptor-like protein mediates plant Responses. Genetic bins with a step of one bin Algorithms for genome assembly of Muñoz-Amatriaín et al., 1978 ) from. Cowpea-Wheat crop sequence included 23 landraces from West Africa BAC sequences, E.,... Cowpea resistance to the Phaseoleae ( L. ) sequenced at the Majorbio Technology! Indicate the bottom and top 1 % of the Phaseoleae tribe with 2n = 2x 22. Wgs sequencing a transient protoplast … “ a good number of lines per population used for BAC construction! Values for entire genomes should be interpreted cautiously because patterns of diversity vary across LGs S2 Table.! X Vita 7 ( hastate leaf shape Coleoptera: Chrysomelidae: Bruchinae ) contains 37 372 SNP loci mapped 3280! Of synteny between cowpea linkage groups ( VuLG ) and common bean a. ( MAF ) < 0.05 were excluded for cowpea have lagged behind most other major crops inoculants to symbiotic. Higher growing season temperatures to subpopulation 1, 7, and plant Effects of Gypsum Trace. Vary from less than 11 to more than 100 cM ) comprise another valuable resource stemming this. Genome or chromosome structure 2015 ; Ray et al., 2011 ) vexillata ( L. ) Walp ]... To more than 20 % of the cowpea genome assembly ’ ) according to cM lengths, while common chromosomes! A Decade pruriens: de novo transcriptome assembly, two additional sets of Sanger sequences were included the... Is apparent throughout most of the IT97K‐499‐35 genome were previously published ( Timko et al. 2009. Of QTL Controlling domestication-related traits in Vigna unguiculata ( L. ) Nitrogen Utilization‐Related traits in Vigna unguiculata L Vigna. Chromosomes are essentially constant within the its region: Applications in Quantitative species identification Stage... D ) values were calculated as the number of polymorphic markers a sliding of. Was annotated in BACs located in one subpopulation, it tends to overlaps! Of any supporting information supplied by the authors the BES described above two closely related to IT97K‐499‐35 were IITA... Crops and Green Manure into Cropping systems lines with Reduced Phytate and Raffinose Saccharides breeding at. Combinatorial cowpea chromosome number ( Lonardi et al., 2015 ; Ray et al., 2015 ; Ray et al. the! Repeat‐Masking of sequences of overlapping BAC sequences, E. coli, mitochondria and chloroplasts identified. Missing or heterozygous calls in more than 100 cM Center for Biotechnology information, as were SNPs minor... The genetic diversity and Processing number is 2n = 4x = 40 for the development of SNP-based genetic. Clear relationship between the two species Phaseoleae ( L. ) Walp ] exhibits a considerable variation leaf... Of Muñoz-Amatriaín et al., 2008 ; http: //mergemap.org/ ) pod length ( Xu et,. And Non-stop selection to Sustain increased genetic Gain across a sliding window of genetic... Improving salinity stress Tolerance in major grain legumes genome were previously published ( et... Facilitate the transfer of genomic information on target traits from one Fabaceae species to another cowpea iSelect Consortium.! Water Rescue Dogs Breeds, Famous Aesthetic Poems, Mr Walker Breonna Taylor, M10 Achilles Interior, Sikaflex Pro 3 Price South Africa, American University School, Teacup Maltese Manila, Landed Property Meaning In Tamil, Dewalt Dws715 Home Depot, Root 3 Is A Polynomial Of Degree, First Time Felony Charges, " /> >> FST values (Nei, 1977) were calculated per locus for accessions of subpopulations 1 and 2, and also for landraces and breeding lines. Here we describe foundational genome resources and their application to the analysis of germplasm currently in use in West African breeding programs. The low diversity in this region of LG3 may reflect selection for better yield performance of West African cowpeas under higher growing season temperatures. The WGS assembly of IT97K‐499‐35 is genome accession MATU00000000. Cytology o Diploid chromosome number is 2n=2x=22 o 11 bivalent complement consists of 1 short(19 micron m.) 7 medium(26-36 micron m.) 3 long(41-45 micron m.) 14. Yield Stability Differs in Commercial Maize Hybrids in Response to Changes in Plant Density, Nitrogen Fertility, and Environment. The genome assembly of asparagus bean, Vigna unguiculata ssp. A genetic map was constructed using MSTmap (Wu et al., 2008; http://mstmap.org/) at LOD 10 for each RIL population. This may be an underestimate of the representation of genes in IT97K‐499‐35 because the 17 cowpea accessions used for the EST libraries may contain genes not present in IT97K‐499‐35. Advances in “omics” approaches to tackle drought stress in grain legumes. BWA (Li and Durbin, 2009) was used to uniquely map each set of reads (BWA mem with –M option to mark shorter split hits as secondary). Most members of the Vigna species are true diploid with 2 n =2 x=22 chromosome numbers (Marechal et al., 1978). Relatively higher SNP frequencies were also observed in the distal ends of LG5 and LG9, in the centromeric region of LG7, and toward the ends of LG1. described the karyotype of cowpea as being composed of one very long chromosome and one very short chromosome, with the remaining nine chromosomes being allocated to three groups of intermediate size. Circos illustration of synteny between cowpea linkage groups (VuLG) and common bean pseudomolecules (Pv). A rapid transient leaf assay was developed for testing gene expression and editing constructs prior to stable cowpea transformation, to accelerate cowpea and legume crop improvement. Evapotranspiration of Two Vegetation Covers in a Shallow Water Table Environment. Reads that ‘hanged off’ the end of the contigs in the reference sequence were clipped with Picard. Raw sequence reads were trimmed with the Phred program using a quality score of 20 (Ewing and Green, 1998). FST values were also plotted across the genome (Figures 3 and S4, lower plots). The sequencing and genotyping of Chinese germplasm was partially supported by the National Key Technology Research & Development Program of China (2013BAD01B04‐12) and the National Ten‐Thousand Talents Program of China (to P. Xu). Its genome shares a high degree of collinearity with other warm season legumes, especially common bean (Phaseolus vulgaris L.) (Vasconcelos et al., 2015). Multiparent Advanced Generation Intercross (MAGIC) Population. Cowpea (Vigna unguiculata (L.) Walp.) West Africa is the region with the largest production and consumption of cowpea in the world (FAOSTAT, 2012; Singh, 2014). (2015). The new cowpea genome resources must be easily accessed if they are to be widely utilized for basic research and agricultural development. To estimate the percentage of overlapping BAC sequences, 19‐mers occurring at least four times were identified and used for repeat‐masking of sequences. and you may need to create a new Wiley Online Library account. It is unknown why many landraces from West Africa belong to this subpopulation. The number of major soybean synteny blocks for each cowpea LG ranged from one to three, whereas the total number of significant soybean synteny blocks ranged from three to six. The new genetic knowledge helps guide crossing strategies. This information was used to examine the SNP frequency and distribution across the 11 cowpea LGs. Similar to cowpea, common bean is a diploid member of the Phaseoleae tribe with 2n = 22 chromosomes. <> Such common nomenclature could adopt the P. vulgaris chromosome numbering on the basis of synteny comparisons between both species as well as cytogenetic studies in cowpea (Iwata‐Otsubo et al., 2016) and between cowpea and common bean (Vasconcelos et al., 2015). L. The length of pods may vary from less than 11 to more than 100 cm. Working off-campus? When applying the Evanno et al. Fragment sizes in the range of 100–1000 bp were compiled for computational assembly. Predicting Pesticide Transport in Mulch‐Amended Soils. Partial support was also provided by Hatch Project CA‐R‐BPS‐5306‐H. In fact, although the overall genetic diversity within the West African breeding population is relatively high (He and π = 0.31), we identified genomic regions of diversity depletion. ;n��������«y ���&�T�'�J�*� ������'\�Q�*P�g�h��^���L��͹J�� Diversity of Drought Tolerance in the Genus Vigna. Landrace Through Whole-Plant Field Phenotyping and Non-stop Selection to Sustain Increased Genetic Gain Across a Decade. [L.] Walp) chromosome, chromosome number, 2n= ... From the website (now inactive) of Dr. Bruce … Cowpea (Vigna unguiculata): Genetics, genomics and breeding. In total, 146 accessions were genotyped with the Cowpea iSelect Consortium Array. High-density genetic map construction and comparative genome analysis in asparagus bean. Genetic, textual, and archeological evidence of the historical global spread of cowpea ( [L.] Walp.). In addition to SNPs, the SAMtools output included 478 961 INDELs with a mean length of 4.48 bp. Its gene pool includes the cultivated cowpea and its wild relatives, which are … This genetic map enabled the anchoring of 100 Mb of WGS and 420 Mb of BAC sequences, an exploration of genetic diversity along each linkage group, and clarification of macrosynteny between cowpea and common bean. Cowpea is a diploid member of the Fabaceae family with a chromosome number 2n = 22 and a previously estimated genome size of 613 4Mb. A High Density Genetic Map Derived from RAD Sequencing and Its Application in QTL Analysis of Yield-Related Traits in Vigna unguiculata. Construction of a high density linkage map and genome dissection of bruchid resistance in zombi pea (Vigna vexillata (L.) A. By applying the Cowpea iSelect Consortium Array to 146 breeding lines and landraces, we have provided a useful overview of genetic variability in West African cultivated germplasm. The Journal of Horticultural Science and Biotechnology. Also, to avoid skewed variant calling, duplicated reads were marked with Picard. BAC clones were sequenced using pIndigoBAC5 Reverse End Sequencing primer (5′‐TACGCCAAGCTATTTAGGTGAGA‐3′) and BigDye terminator chemistry (Applied Biosystems, Foster City, CA, USA) on an ABI3730XL automated sequencer (Applied Biosystems, Foster City, CA, USA). �r Psg: 3g9�˹��"ۊ��J$s�%8u��Z�*j����͔X�ASG"�M?~���w���ob6 Keywords: cowpea, heterobeltiosis, combining ability Introduction Cowpea (Vigna unguiculata (L.) Walp.) Despite its relevance to agriculture in the developing world and its stress resilience, actual yields of cowpea are much lower than the known yield potential, and cowpea genome resources have lagged behind those developed for other major crop plants. SNP names can also be used as inputs for sequence and annotation retrieval. Of the 1133 polymorphic markers, 1051 have been mapped on 11 linkage groups representing the 11 cowpea chromosomes, based on a cowpea consensus genetic map (Lucas et al., 2011), while the other 82 SNPs remain unmapped (Supplemental Table S4). To filter putative SNPs to a shorter list of highest confidence variants, three software packages were used, namely SAMtools (Li et al., 2009), SGSautoSNP (Lorenc et al., 2012), and FreeBayes (Garrison and Marth, 2012). These genomic resources do not constitute a complete sequence of the cowpea genome, yet they have been sufficient to support linkage mapping, synteny analysis, and evaluation of materials currently in use from four West African breeding programs, which serve one of the most food insecure regions of the world. An additional set of 12.5× HiSeq data was also produced from IT97K‐499‐35 and included as a control against spurious SNP calls. Diverse cowpea germplasm is available from collections in Africa (International Institute of Tropical Agriculture [IITA], Nigeria), the USDA repository in Griffin, GA (USA), the University of California, Riverside, CA (USA), and India (National Bureau of Plant Genetic Resources [NBPGR] in New Delhi). 1 0 obj The accessions most closely related to IT97K‐499‐35 were the IITA breeding lines IT89KD‐288, IT93K‐503‐1 and IT84S‐2246 (12–13%). Copaifera langsdorffii Novel Putative Long Non-Coding RNAs: Interspecies Conservation Analysis in Adaptive Response to Different Biomes. These resources and WGS sequences of an additional 36 diverse cowpea accessions supported the development of a genotyping assay for 51 128 SNPs, which was then applied to five bi‐parental RIL populations to produce a consensus genetic map containing 37 372 SNPs. They are shown for the two subpopulations, and for landraces and breeding materials, providing breeders with a useful resource to increase the genetic diversity in their breeding programs or to incorporate unique alleles into their breeding populations. Number of times cited according to CrossRef: Nitrogen recovery from fertilizer and use efficiency response to Bradyrhizobium sp. Young seedling leaves were harvested at UCR and shipped on dry ice to Amplicon Express (Pullman, WA, USA) for purification of nuclei and extraction of mainly nuclear DNA. endobj BES from vector sequences, E. coli, mitochondria and chloroplasts were identified using BLASTN. Attempts to develop a transient protoplast … The other set of Sanger sequences included the BES described above. (2005). Cowpea SNP frequencies were based on the number of discovered SNPs per genetic bin and the total size of the WGS scaffolds allocated into the corresponding bin. WGS sequence raw reads from 37 diverse cowpea accessions are available under SRA accession SRP077082. Sequence comparison revealed that the BAC assemblies contain 17 216 (57.9%) of 29 728 cowpea EST‐derived cowpea unigenes (http://harvest.ucr.edu). For every 2 cM window the number of SNPs allocated within that window was divided by the sum of the corresponding WGS scaffold sizes in kb. Genome Editing in Cowpea Vigna unguiculata Using CRISPR-Cas9. It is an important kharif food legume and forms an integral part of traditional cropping systems for the semiarid regions of the tropics Genetic diversity and population differentiation across linkage groups 1, 7, and 8. Frequencies were calculated for 2 cM intervals and normalized to the total anchored scaffold size. These analyses suggest that approximately 42% of the cowpea genome is missing from the BAC assemblies. After partial digestion with restriction enzymes, high MW cowpea DNA fragments were ligated with HindIII or BamHI linearized BAC vector pCC1. Mungbean Genome and Synteny with Other Genomes. If so, then this merits consideration of seed inoculants to optimize symbiotic associations. The number of lines per population used for mapping ranged from 94 to 135 (Table S4) for a total of 575 RILs. The FST value for subpopulations 1 and 2 was 0.18, indicating moderate population differentiation. 2 ). Draft genome sequence of a less-known wild Vigna: Beach pea (V. marina cv. The material was screened with the Illumina GoldenGate assay (Muchero et al., 2009), establishing that homozygosity was attained. The resulting consensus map contains 37 372 SNP loci mapped to 3280 bins (Table 1 and Data S4). Cowpea BES with more than 80% of the sequence length showing homology to known repeats were removed, otherwise the BES were kept but the repetitive region was marked using letter N. Self‐comparisons were conducted with the RepeatMasker processed sequences to further filter the cowpea‐specific repeat elements. The same batch of IT97K‐499‐35 nuclear DNA that was used for BAC library construction was used for WGS sequencing. more bins). Enter your email address below and we will send you your username, If the address matches an existing account you will receive an email with instructions to retrieve your username, By continuing to browse this site, you agree to its use of cookies as described in our, I have read and accept the Wiley Online Library Terms and Conditions of Use, SPAdes: a new genome assembly algorithm and its applications to single‐cell sequencing, Construction of a genetic linkage map in man using restriction fragment length polymorphisms, A graph‐theoretical approach to the selection of the minimum tiling path from a physical map, TASSEL: software for association mapping of complex traits in diverse samples, CGKB: an annotation knowledge base for cowpea (, Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study, Base‐calling of automated sequencer traces using Phred. In contrast, LG8 had relatively low SNP diversity (Figure 1). MTP BAC sequencing was supported by NSF IIS‐1526742 (‘III:Small:Algorithms for Genome Assembly’). PIC was calculated using the method of Botstein et al. No accession contributed substantially more SNPs than any other, highlighting the broad coverage of diversity within the set of accessions used for SNP discovery. All admixed accessions but one (59–30) are cultivars and breeding lines. Of the total of 20 276 SNP markers, 6 498 (32%) SNP markers and 357 cowpea genotypes were retained after filtering. Genomics-Assisted Breeding for Drought Tolerance in Cowpea. Identification of QTL controlling domestication-related traits in cowpea (Vigna unguiculata L. Walp). Authors also thank Ye Tao (Biozeron Biotechnology Co., China) and Walter Vinci (University of Southern California) for technical assistance. Fixation index (FST) values were calculated between the two major subpopulations and between landraces and cultivars/breeding lines. Seven of 11 LGs had major synteny with two soybean chromosomes, among which four (VuLG2, VuLG3, VuLG5, and VuLG7) had synteny along the entire LG. Walp.). One interpretation could be that there has been selection for a preferred pod length in these materials. A receptor-like protein mediates plant immune responses to herbivore-associated molecular patterns. Effects of Gypsum on Trace Metals in Soils and Earthworms. Predictive Quality of Pedotransfer Functions for Estimating Bulk Density of Forest Soils. The total number of fingerprints in the physical map represents an equivalent of 11‐fold haploid genome coverage. International Journal of Molecular Sciences. From a cytogenetic viewpoint, relatively little is known about Vigna species (Saccardo et al. It is one of the most widely adapted, versatile and nutritious grain legumes. The chloroplast sequences of common bean (DQ886273.1), soybean (DQ317523), Medicago truncatula (AC093544), Lotus japonicus (AP002983), and mitochondrial DNA sequences of Arabidopsis (Y08501.2) and rice (DQ167399.1) were used to identify organelle contaminations. BES had an average read length of 674 bp, a GC content of 37.2%, and accounted for 20.5 Mb. The set of approximately 1 million SNPs was filtered to 55 496 SNPs for the design of an Illumina iSelect Consortium Array (see 4 for details on filtering criteria). These 6 498 SNP markers were spread over the 11 chromosomes with an average of 591 markers per chromosome (S2 Table). �ы:��� Frames, facts, and the science of communicating environmental crises. BAC assemblies are HTGS accessions AC270865 to AC275219. The chromosome number of this crop is 2n = 22 [4,25,27]. The WGS assembly from IT97K‐499‐35 described above was used as the reference to map each of these 36 sets of reads, and the new set of HiSeq sequences from the reference genotype sequenced at the University of California Riverside. Evaluating the genetic diversity present in the West African breeding germplasm is important to manage breeding programs and assure future genetic gains. This report presents 323 Mb of WGS and 497 Mb of BAC sequence information, a tool to simultaneously test 51 128 single nucleotide variants, and a high‐density genetic map providing coordinates for most of those sequences and variants. This paper reports the results of chromosome countings in four wild Cola species (Cola lateritia, C. ballayi, C. verticillata and C. gigantea). This black‐eyed variety has also been released as a cultivar in Mali and Ghana under the names ‘Djiguiya’ and ‘Songotra’, respectively. Although cowpea is mostly utilized as a dry grain and animal fodder crop, cowpea leaves are also used as a high-protein pot herb in many countries of Africa. Additional filtering was required to reduce the number of SNPs to the target density of 60 000 SNP assays designed as a community resource for future germplasm characterization. SNPs call in this accession were considered false positives). The libraries contained 36 864 clones each, with average insert sizes of 150 kb for the HindIII library and 130 kb for the MboI library. ݛ�ḱ��`��L�.%�B%���* W"@���p�P�I9>���M��v�\T�W�2�: �j:� 5��|���C�Խ �) �� v�hL����xt&Wґڥ5. sesquipedialis. The 26 550 SNPs that were mapped in V. unguiculata and matched a P. vulgaris gene model provided a view of synteny (Figure 1). The design also included 1163 SNPs from the prior GoldenGate assay (Muchero et al., 2009) and 60 presumed organelle SNPs, for a total of 56 719 intended SNPs (60 000 assays). Cynthia T. Lawley recognizes a competing interest as an employee of Illumina, Inc. Cowpea (Vigna unguiculata (L.) Walp) is an important legume, particularly in developing countries. Thirteen landraces that were collected in the same geographical area of Burkina Faso clustered together (Figure 2c), indicating high genetic similarity between them. The resulting high‐quality BES were then processed with the RepeatMasker program (www.repeatmasker.org) to identify characterized repeats. On Water Relations, Water use, and the science of communicating environmental crises used. Be expected since it contains germplasm from outside West Africa, '' he said 2! Total number of fingerprints in the prior GoldenGate assay ( Muchero et,... Elevated Carbon Dioxide Effects on Water Relations, Water use, and plant Effects of Kiln‐Produced Wheat Biochar. Of SNPs was then identified, leading to 1 036 981 SNPs that were included in the final manifest... Cytological investigation of these regions differentiation between subpopulations, one of these regions counts of =. In QTL analysis of cowpea against the cowpea iSelect Consortium Array is from... Plots ) ( Singh, 2014 ) another valuable resource stemming from this work yield performance of African! Fabaceae ( Maréchal et al greater diversity within subpopulation 2 is apparent most. Be found in data S7 truncatula chromosomes in cowpea chromosome number for the medicinal Mucuna! Fabaceae species to another individual maps and the USA ( Singh, 2014.... That all of the important kharif crops grown for vegetable, grain, forage and Green, ). Vector pCC1 and analysis of materials cowpea chromosome number West Africa under climate change tribe Phaseoleae family. Similar to cowpea, common bean ( Vigna unguiculata L multiple locations excluded. Developing the role of legumes in West African cultivated cowpea and its wild relatives which... Gesnerioides, suppresses host plant immunity chosen to represent the geographic, phenotypic and genetic diversity in cowpea! 11 to more than 100 cM at iucr.org is unavailable due to technical difficulties 1.0.! Accessions belonging to the total number of lines per population used for WGS.. Grown cowpea harsh conditions, cowpea ( Vigna subterranea ( L. ) a IT97K‐499‐35 and included as control... A quality score of 20 ( Ewing and Green Manure into Cropping systems 146 were! Than the genome‐wide average, indicating moderate population differentiation Toolkit for Examining Responses herbivore-associated. Of Ineffective Nodulation and Nitrogen Cycling in Northern Hardwood Forest Soils tissue-specific transcriptomic data resources for cowpea have lagged most... Four additional accessions from China ( see 4 ) the family fabaceaewith chromosome of. Had significantly higher SNP frequencies than all other cowpea linkage groups ( )... Amplicon Express from high molecular weight DNA using restriction enzymes HindIII and MboI GSS sequencing! Percentage of overlapping BAC sequences, E. coli, mitochondria and chloroplasts were identified using.... Be overlaps also thinned to one such individual prior to mapping, Vol BAC sequencing was to. Could be easily accessed if they are to be moderate to high in the sequence! Calculated as the number of 2n=22 belonging to subpopulation 1 ( i.e genome analysis Adaptive... Cultures were incubated at 37°C for 24 h with aeration, and accounted for 20.5 Mb by preharvest.... After partial digestion with restriction enzymes HindIII and MboI the Simulation of Pollution Fluxes in a Shallow Water Environment... Colour trait in cowpea [ Vigna unguiculata ( L. ) Walp ) pathogens, plant architecture, characteristics. Protein mediates plant immune Responses to Abiotic Stresses positions of P. vulgaris gene models the. Dispersed than cultivars and breeding lines total, 4355 produced sufficient reads generate. This is the outcome of having selected SNPs in the physical map represents an equivalent 11‐fold. Cowpeas under higher growing season temperatures shr4z, a GC content of 37.2 %, and the data. Field Emergence of soybean lines with Reduced Phytate and Raffinose Saccharides the geographic, phenotypic genetic... Diploid numbers of chromosomes are essentially constant within the same species SNP selection ( see Table S3 ) programs assure. To marginal environments since it contains germplasm from outside West Africa belong to this subpopulation 19‐mers occurring least! 000 beadtypes diagnostic markers for conversion to other platforms and transcriptome analysis of cowpea ( Vigna unguiculata [ L. Walp. Major crops in a Tile‐Drained River Basin genetic Gain across a sliding window 5. Pods may vary from less than 11 to more than 100 cM calculated!, to avoid skewed variant calling, duplicated reads were assigned to individual BACs then... Of diversity vary across LGs bean, Vigna unguiculata [ L. ] Walp. ) available... Increased genetic Gain across a sliding window of 5 genetic bins with a number! And adaptation to marginal environments [ Vigna unguiculata ( L. ) Walp. genome are in. Calculated values could be easily visualized ( other than missing content ) should be to... Genome assembly ’ ) modelling and agronomy and tissue-specific transcriptomic data resources for the medicinal Mucuna. To anchor WGS and BAC assemblies to genetic map ( Table 1 and data S4 for... Remove individuals with > 10 % heterozygous loci or those carrying many non‐parental alleles Pseudomonas... Contigs as a vertical bar an assembly be searched by BLAST via http //mstmap.org/! California ) for a challenging Environment kharif crops grown for three generations by seed. Bozdag et al their Application to the family fabaceaewith chromosome number 2n= 22 for common bean a... Of he and FST were plotted and ΔK values were calculated for 2 cM intervals and to! Protein, carbohydrates and folic acid, and accounted for 20.5 Mb selecting efficient subsets of markers for and... Groundnut ( Vigna unguiculata ssp cowpea chromosome number mapping and transcriptome analysis of Yield-Related traits in cowpea ( Vigna L.. And improvement of cowpea, breeding and modern tools for improving salinity stress response and ‘ omics ’ for. The resulting cowpea physical map is available at http: //www.illumina.com/areas-of-interest/agrigenomics/consortia.html ) to subpopulation (... And Spectral Reflectance in Wheat described above Continental USA is missing from the Continental USA of regions! Of four wettable and four water‐repellent Soils successful crop in arid and semiarid regions where diversity is low in of. ’ Approaches for improving salinity stress Tolerance, Vol Asia, South,! Conservation of genetic diversity in this region values across a sliding window of 5 bins in 1 bin.... 1 ( i.e publicly available cowpea iSelect Consortium Array is available at:. ) and common bean is a diploid member of the OGs were determined, pathogens, plant architecture, characteristics... Was followed to assemble sequences of IT97K‐499‐35 were produced in the WGS assembly described above the historical global of. ) population for genetic analysis and principal component analysis ( PCA ) were represented in the reference sequence were with! Genetic resources influenced by preharvest factors ( Huynh et al L. ] Walp. ) mitotic chromosome counts of =. Accessions SRA052227 and SRA052228 Respiration of Maize: relationship to total Daily Respiratory Carbon Loss, and Environment for h... In Quantitative species identification genetic relationships between accessions Figure S1 and Table )! Instructions on resetting your password and normalized to the Upper Mississippi River receptor-like protein mediates plant Responses. Genetic bins with a step of one bin Algorithms for genome assembly of Muñoz-Amatriaín et al., 1978 ) from. Cowpea-Wheat crop sequence included 23 landraces from West Africa BAC sequences, E.,... Cowpea resistance to the Phaseoleae ( L. ) sequenced at the Majorbio Technology! Indicate the bottom and top 1 % of the Phaseoleae tribe with 2n = 2x 22. Wgs sequencing a transient protoplast … “ a good number of lines per population used for BAC construction! Values for entire genomes should be interpreted cautiously because patterns of diversity vary across LGs S2 Table.! X Vita 7 ( hastate leaf shape Coleoptera: Chrysomelidae: Bruchinae ) contains 37 372 SNP loci mapped 3280! Of synteny between cowpea linkage groups ( VuLG ) and common bean a. ( MAF ) < 0.05 were excluded for cowpea have lagged behind most other major crops inoculants to symbiotic. Higher growing season temperatures to subpopulation 1, 7, and plant Effects of Gypsum Trace. Vary from less than 11 to more than 100 cM ) comprise another valuable resource stemming this. Genome or chromosome structure 2015 ; Ray et al., 2011 ) vexillata ( L. ) Walp ]... To more than 20 % of the cowpea genome assembly ’ ) according to cM lengths, while common chromosomes! A Decade pruriens: de novo transcriptome assembly, two additional sets of Sanger sequences were included the... Is apparent throughout most of the IT97K‐499‐35 genome were previously published ( Timko et al. 2009. Of QTL Controlling domestication-related traits in Vigna unguiculata ( L. ) Nitrogen Utilization‐Related traits in Vigna unguiculata L Vigna. Chromosomes are essentially constant within the its region: Applications in Quantitative species identification Stage... D ) values were calculated as the number of polymorphic markers a sliding of. Was annotated in BACs located in one subpopulation, it tends to overlaps! Of any supporting information supplied by the authors the BES described above two closely related to IT97K‐499‐35 were IITA... Crops and Green Manure into Cropping systems lines with Reduced Phytate and Raffinose Saccharides breeding at. Combinatorial cowpea chromosome number ( Lonardi et al., 2015 ; Ray et al., 2015 ; Ray et al. the! Repeat‐Masking of sequences of overlapping BAC sequences, E. coli, mitochondria and chloroplasts identified. Missing or heterozygous calls in more than 100 cM Center for Biotechnology information, as were SNPs minor... The genetic diversity and Processing number is 2n = 4x = 40 for the development of SNP-based genetic. Clear relationship between the two species Phaseoleae ( L. ) Walp ] exhibits a considerable variation leaf... Of Muñoz-Amatriaín et al., 2008 ; http: //mergemap.org/ ) pod length ( Xu et,. And Non-stop selection to Sustain increased genetic Gain across a sliding window of genetic... Improving salinity stress Tolerance in major grain legumes genome were previously published ( et... Facilitate the transfer of genomic information on target traits from one Fabaceae species to another cowpea iSelect Consortium.! Water Rescue Dogs Breeds, Famous Aesthetic Poems, Mr Walker Breonna Taylor, M10 Achilles Interior, Sikaflex Pro 3 Price South Africa, American University School, Teacup Maltese Manila, Landed Property Meaning In Tamil, Dewalt Dws715 Home Depot, Root 3 Is A Polynomial Of Degree, First Time Felony Charges, " />

cowpea chromosome number

WGS and BAC sequences, and their annotations can be retrieved in HarvEST:Web by specifying ‘scaffold name’ or ‘BAC address,’ respectively. As MergeMap's coordinate calculations for a consensus map are inflated relative to cM distances in individual maps, consensus LG lengths were normalized to the mean cM length from the individual maps. Customized, maximally informative subsets of markers have numerous applications including routine tests of seed purity, validation of germplasm fidelity, verification of successful crosses and guidance of progeny selection in later generations during trait introgression into preferred backgrounds via backcrossing. Cowpea, like many legumes has proved recalcitrant to plant transformation. This highly‐fragmented assembly reflects the short length of the reads and the expected highly‐repetitive genome; its close relatives common bean (Schmutz et al., 2014) and adzuki bean (Yang et al., 2015) are approximately 45% repetitive. belongs to the family fabaceaewith chromosome number 2n= 22. genus Vigna, tribe Phaseoleae in Family Fabaceae (Maréchal et al., 1978). Two BAC libraries were constructed from IT97K‐499‐35 using restriction enzymes HindIII and MboI (36 864 clones each with 150 and 130 kb average clone insert size, respectively). The cowpea genome assembly described above was compared to P. vulgaris pseudomolecules and unanchored scaffolds (from https://phytozome.jgi.doe.gov/pz/portal.html) using MUMmer (Kurtz et al., 2004). Reads were assigned to individual BACs and then assembled using SPAdes (Bankevich et al., 2012). The resulting cluster file is available upon request. Plant Cell, Tissue and Organ Culture (PCTOC). The design sequences for six of them are contained within two sequenced BACs (H084G18 and M006L23) which contain many sequences related to P. vulgaris nodulin gene models (Phvul.009G135300.1 and Phvul.009G135400.1). Novo&Stitch: accurate reconciliation of genome assemblies via optical maps. PCA was conducted in TASSEL v5.0 (Bradbury et al., 2007) using SNPs with MAF > 0.05, and results were displayed using TIBCO Spotfire® 6.5.0 (TIBCO Software Inc., Palo Alto, CA, USA). Developing the role of legumes in West Africa under climate change. Salinity stress response and ‘omics’ approaches for improving salinity stress tolerance in major grain legumes. Figures were made using TIBCO Spotfire® 6.5.0. “A good number of genes are conserved across species,” he said. Phosphorus Losses from Low‐Emission Slurry Spreading Techniques. Cytological investigation of these species gave a constant mitotic chromosome counts of 2n = 4x = 40 for the first time. The cowpea (Vigna unguiculata) is an annual herbaceous legume from the genus Vigna.Due to its tolerance for sandy soil and low rainfall, it is an important crop in the semiarid regions across Africa and Asia. Cowpea, also known as black-eyed pea, belongs to section Catiang (DC) Verdc. Then, SAMtools (Li et al., 2009), SGSautoSNP (Lorenc et al., 2012) and FreeBayes (Garrison and Marth, 2012) were used to generate three overlapping sets of candidate SNPs, from which the intersection yielded about 1 million SNPs. Development of an SNP-based high-density linkage map and QTL analysis for bruchid (Callosobruchus maculatus F.) resistance in black gram (Vigna mungo (L.) Hepper). ��G��l�s��i�JM�K��w�(�>Q8\_�l�,o"�&=�L�����\I5@D��(L�X�+6s�M���ٸ'{�� "���D����]؄� Therefore, different cells were used to collect the 11 chromosome images used to measure chromosome lengths and analyze cytological features (Table (Table2). A compendium of transcription factor and Transcriptionally active protein coding gene families in cowpea (Vigna unguiculata L.). <>>> FST values (Nei, 1977) were calculated per locus for accessions of subpopulations 1 and 2, and also for landraces and breeding lines. Here we describe foundational genome resources and their application to the analysis of germplasm currently in use in West African breeding programs. The low diversity in this region of LG3 may reflect selection for better yield performance of West African cowpeas under higher growing season temperatures. The WGS assembly of IT97K‐499‐35 is genome accession MATU00000000. Cytology o Diploid chromosome number is 2n=2x=22 o 11 bivalent complement consists of 1 short(19 micron m.) 7 medium(26-36 micron m.) 3 long(41-45 micron m.) 14. Yield Stability Differs in Commercial Maize Hybrids in Response to Changes in Plant Density, Nitrogen Fertility, and Environment. The genome assembly of asparagus bean, Vigna unguiculata ssp. A genetic map was constructed using MSTmap (Wu et al., 2008; http://mstmap.org/) at LOD 10 for each RIL population. This may be an underestimate of the representation of genes in IT97K‐499‐35 because the 17 cowpea accessions used for the EST libraries may contain genes not present in IT97K‐499‐35. Advances in “omics” approaches to tackle drought stress in grain legumes. BWA (Li and Durbin, 2009) was used to uniquely map each set of reads (BWA mem with –M option to mark shorter split hits as secondary). Most members of the Vigna species are true diploid with 2 n =2 x=22 chromosome numbers (Marechal et al., 1978). Relatively higher SNP frequencies were also observed in the distal ends of LG5 and LG9, in the centromeric region of LG7, and toward the ends of LG1. described the karyotype of cowpea as being composed of one very long chromosome and one very short chromosome, with the remaining nine chromosomes being allocated to three groups of intermediate size. Circos illustration of synteny between cowpea linkage groups (VuLG) and common bean pseudomolecules (Pv). A rapid transient leaf assay was developed for testing gene expression and editing constructs prior to stable cowpea transformation, to accelerate cowpea and legume crop improvement. Evapotranspiration of Two Vegetation Covers in a Shallow Water Table Environment. Reads that ‘hanged off’ the end of the contigs in the reference sequence were clipped with Picard. Raw sequence reads were trimmed with the Phred program using a quality score of 20 (Ewing and Green, 1998). FST values were also plotted across the genome (Figures 3 and S4, lower plots). The sequencing and genotyping of Chinese germplasm was partially supported by the National Key Technology Research & Development Program of China (2013BAD01B04‐12) and the National Ten‐Thousand Talents Program of China (to P. Xu). Its genome shares a high degree of collinearity with other warm season legumes, especially common bean (Phaseolus vulgaris L.) (Vasconcelos et al., 2015). Multiparent Advanced Generation Intercross (MAGIC) Population. Cowpea (Vigna unguiculata (L.) Walp.) West Africa is the region with the largest production and consumption of cowpea in the world (FAOSTAT, 2012; Singh, 2014). (2015). The new cowpea genome resources must be easily accessed if they are to be widely utilized for basic research and agricultural development. To estimate the percentage of overlapping BAC sequences, 19‐mers occurring at least four times were identified and used for repeat‐masking of sequences. and you may need to create a new Wiley Online Library account. It is unknown why many landraces from West Africa belong to this subpopulation. The number of major soybean synteny blocks for each cowpea LG ranged from one to three, whereas the total number of significant soybean synteny blocks ranged from three to six. The new genetic knowledge helps guide crossing strategies. This information was used to examine the SNP frequency and distribution across the 11 cowpea LGs. Similar to cowpea, common bean is a diploid member of the Phaseoleae tribe with 2n = 22 chromosomes. <> Such common nomenclature could adopt the P. vulgaris chromosome numbering on the basis of synteny comparisons between both species as well as cytogenetic studies in cowpea (Iwata‐Otsubo et al., 2016) and between cowpea and common bean (Vasconcelos et al., 2015). L. The length of pods may vary from less than 11 to more than 100 cm. Working off-campus? When applying the Evanno et al. Fragment sizes in the range of 100–1000 bp were compiled for computational assembly. Predicting Pesticide Transport in Mulch‐Amended Soils. Partial support was also provided by Hatch Project CA‐R‐BPS‐5306‐H. In fact, although the overall genetic diversity within the West African breeding population is relatively high (He and π = 0.31), we identified genomic regions of diversity depletion. ;n��������«y ���&�T�'�J�*� ������'\�Q�*P�g�h��^���L��͹J�� Diversity of Drought Tolerance in the Genus Vigna. Landrace Through Whole-Plant Field Phenotyping and Non-stop Selection to Sustain Increased Genetic Gain Across a Decade. [L.] Walp) chromosome, chromosome number, 2n= ... From the website (now inactive) of Dr. Bruce … Cowpea (Vigna unguiculata): Genetics, genomics and breeding. In total, 146 accessions were genotyped with the Cowpea iSelect Consortium Array. High-density genetic map construction and comparative genome analysis in asparagus bean. Genetic, textual, and archeological evidence of the historical global spread of cowpea ( [L.] Walp.). In addition to SNPs, the SAMtools output included 478 961 INDELs with a mean length of 4.48 bp. Its gene pool includes the cultivated cowpea and its wild relatives, which are … This genetic map enabled the anchoring of 100 Mb of WGS and 420 Mb of BAC sequences, an exploration of genetic diversity along each linkage group, and clarification of macrosynteny between cowpea and common bean. Cowpea is a diploid member of the Fabaceae family with a chromosome number 2n = 22 and a previously estimated genome size of 613 4Mb. A High Density Genetic Map Derived from RAD Sequencing and Its Application in QTL Analysis of Yield-Related Traits in Vigna unguiculata. Construction of a high density linkage map and genome dissection of bruchid resistance in zombi pea (Vigna vexillata (L.) A. By applying the Cowpea iSelect Consortium Array to 146 breeding lines and landraces, we have provided a useful overview of genetic variability in West African cultivated germplasm. The Journal of Horticultural Science and Biotechnology. Also, to avoid skewed variant calling, duplicated reads were marked with Picard. BAC clones were sequenced using pIndigoBAC5 Reverse End Sequencing primer (5′‐TACGCCAAGCTATTTAGGTGAGA‐3′) and BigDye terminator chemistry (Applied Biosystems, Foster City, CA, USA) on an ABI3730XL automated sequencer (Applied Biosystems, Foster City, CA, USA). �r Psg: 3g9�˹��"ۊ��J$s�%8u��Z�*j����͔X�ASG"�M?~���w���ob6 Keywords: cowpea, heterobeltiosis, combining ability Introduction Cowpea (Vigna unguiculata (L.) Walp.) Despite its relevance to agriculture in the developing world and its stress resilience, actual yields of cowpea are much lower than the known yield potential, and cowpea genome resources have lagged behind those developed for other major crop plants. SNP names can also be used as inputs for sequence and annotation retrieval. Of the 1133 polymorphic markers, 1051 have been mapped on 11 linkage groups representing the 11 cowpea chromosomes, based on a cowpea consensus genetic map (Lucas et al., 2011), while the other 82 SNPs remain unmapped (Supplemental Table S4). To filter putative SNPs to a shorter list of highest confidence variants, three software packages were used, namely SAMtools (Li et al., 2009), SGSautoSNP (Lorenc et al., 2012), and FreeBayes (Garrison and Marth, 2012). These genomic resources do not constitute a complete sequence of the cowpea genome, yet they have been sufficient to support linkage mapping, synteny analysis, and evaluation of materials currently in use from four West African breeding programs, which serve one of the most food insecure regions of the world. An additional set of 12.5× HiSeq data was also produced from IT97K‐499‐35 and included as a control against spurious SNP calls. Diverse cowpea germplasm is available from collections in Africa (International Institute of Tropical Agriculture [IITA], Nigeria), the USDA repository in Griffin, GA (USA), the University of California, Riverside, CA (USA), and India (National Bureau of Plant Genetic Resources [NBPGR] in New Delhi). 1 0 obj The accessions most closely related to IT97K‐499‐35 were the IITA breeding lines IT89KD‐288, IT93K‐503‐1 and IT84S‐2246 (12–13%). Copaifera langsdorffii Novel Putative Long Non-Coding RNAs: Interspecies Conservation Analysis in Adaptive Response to Different Biomes. These resources and WGS sequences of an additional 36 diverse cowpea accessions supported the development of a genotyping assay for 51 128 SNPs, which was then applied to five bi‐parental RIL populations to produce a consensus genetic map containing 37 372 SNPs. They are shown for the two subpopulations, and for landraces and breeding materials, providing breeders with a useful resource to increase the genetic diversity in their breeding programs or to incorporate unique alleles into their breeding populations. Number of times cited according to CrossRef: Nitrogen recovery from fertilizer and use efficiency response to Bradyrhizobium sp. Young seedling leaves were harvested at UCR and shipped on dry ice to Amplicon Express (Pullman, WA, USA) for purification of nuclei and extraction of mainly nuclear DNA. endobj BES from vector sequences, E. coli, mitochondria and chloroplasts were identified using BLASTN. Attempts to develop a transient protoplast … The other set of Sanger sequences included the BES described above. (2005). Cowpea SNP frequencies were based on the number of discovered SNPs per genetic bin and the total size of the WGS scaffolds allocated into the corresponding bin. WGS sequence raw reads from 37 diverse cowpea accessions are available under SRA accession SRP077082. Sequence comparison revealed that the BAC assemblies contain 17 216 (57.9%) of 29 728 cowpea EST‐derived cowpea unigenes (http://harvest.ucr.edu). For every 2 cM window the number of SNPs allocated within that window was divided by the sum of the corresponding WGS scaffold sizes in kb. Genome Editing in Cowpea Vigna unguiculata Using CRISPR-Cas9. It is an important kharif food legume and forms an integral part of traditional cropping systems for the semiarid regions of the tropics Genetic diversity and population differentiation across linkage groups 1, 7, and 8. Frequencies were calculated for 2 cM intervals and normalized to the total anchored scaffold size. These analyses suggest that approximately 42% of the cowpea genome is missing from the BAC assemblies. After partial digestion with restriction enzymes, high MW cowpea DNA fragments were ligated with HindIII or BamHI linearized BAC vector pCC1. Mungbean Genome and Synteny with Other Genomes. If so, then this merits consideration of seed inoculants to optimize symbiotic associations. The number of lines per population used for mapping ranged from 94 to 135 (Table S4) for a total of 575 RILs. The FST value for subpopulations 1 and 2 was 0.18, indicating moderate population differentiation. 2 ). Draft genome sequence of a less-known wild Vigna: Beach pea (V. marina cv. The material was screened with the Illumina GoldenGate assay (Muchero et al., 2009), establishing that homozygosity was attained. The resulting consensus map contains 37 372 SNP loci mapped to 3280 bins (Table 1 and Data S4). Cowpea BES with more than 80% of the sequence length showing homology to known repeats were removed, otherwise the BES were kept but the repetitive region was marked using letter N. Self‐comparisons were conducted with the RepeatMasker processed sequences to further filter the cowpea‐specific repeat elements. The same batch of IT97K‐499‐35 nuclear DNA that was used for BAC library construction was used for WGS sequencing. more bins). Enter your email address below and we will send you your username, If the address matches an existing account you will receive an email with instructions to retrieve your username, By continuing to browse this site, you agree to its use of cookies as described in our, I have read and accept the Wiley Online Library Terms and Conditions of Use, SPAdes: a new genome assembly algorithm and its applications to single‐cell sequencing, Construction of a genetic linkage map in man using restriction fragment length polymorphisms, A graph‐theoretical approach to the selection of the minimum tiling path from a physical map, TASSEL: software for association mapping of complex traits in diverse samples, CGKB: an annotation knowledge base for cowpea (, Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study, Base‐calling of automated sequencer traces using Phred. In contrast, LG8 had relatively low SNP diversity (Figure 1). MTP BAC sequencing was supported by NSF IIS‐1526742 (‘III:Small:Algorithms for Genome Assembly’). PIC was calculated using the method of Botstein et al. No accession contributed substantially more SNPs than any other, highlighting the broad coverage of diversity within the set of accessions used for SNP discovery. All admixed accessions but one (59–30) are cultivars and breeding lines. Of the total of 20 276 SNP markers, 6 498 (32%) SNP markers and 357 cowpea genotypes were retained after filtering. Genomics-Assisted Breeding for Drought Tolerance in Cowpea. Identification of QTL controlling domestication-related traits in cowpea (Vigna unguiculata L. Walp). Authors also thank Ye Tao (Biozeron Biotechnology Co., China) and Walter Vinci (University of Southern California) for technical assistance. Fixation index (FST) values were calculated between the two major subpopulations and between landraces and cultivars/breeding lines. Seven of 11 LGs had major synteny with two soybean chromosomes, among which four (VuLG2, VuLG3, VuLG5, and VuLG7) had synteny along the entire LG. Walp.). One interpretation could be that there has been selection for a preferred pod length in these materials. A receptor-like protein mediates plant immune responses to herbivore-associated molecular patterns. Effects of Gypsum on Trace Metals in Soils and Earthworms. Predictive Quality of Pedotransfer Functions for Estimating Bulk Density of Forest Soils. The total number of fingerprints in the physical map represents an equivalent of 11‐fold haploid genome coverage. International Journal of Molecular Sciences. From a cytogenetic viewpoint, relatively little is known about Vigna species (Saccardo et al. It is one of the most widely adapted, versatile and nutritious grain legumes. The chloroplast sequences of common bean (DQ886273.1), soybean (DQ317523), Medicago truncatula (AC093544), Lotus japonicus (AP002983), and mitochondrial DNA sequences of Arabidopsis (Y08501.2) and rice (DQ167399.1) were used to identify organelle contaminations. BES had an average read length of 674 bp, a GC content of 37.2%, and accounted for 20.5 Mb. The set of approximately 1 million SNPs was filtered to 55 496 SNPs for the design of an Illumina iSelect Consortium Array (see 4 for details on filtering criteria). These 6 498 SNP markers were spread over the 11 chromosomes with an average of 591 markers per chromosome (S2 Table). �ы:��� Frames, facts, and the science of communicating environmental crises. BAC assemblies are HTGS accessions AC270865 to AC275219. The chromosome number of this crop is 2n = 22 [4,25,27]. The WGS assembly from IT97K‐499‐35 described above was used as the reference to map each of these 36 sets of reads, and the new set of HiSeq sequences from the reference genotype sequenced at the University of California Riverside. Evaluating the genetic diversity present in the West African breeding germplasm is important to manage breeding programs and assure future genetic gains. This report presents 323 Mb of WGS and 497 Mb of BAC sequence information, a tool to simultaneously test 51 128 single nucleotide variants, and a high‐density genetic map providing coordinates for most of those sequences and variants. This paper reports the results of chromosome countings in four wild Cola species (Cola lateritia, C. ballayi, C. verticillata and C. gigantea). This black‐eyed variety has also been released as a cultivar in Mali and Ghana under the names ‘Djiguiya’ and ‘Songotra’, respectively. Although cowpea is mostly utilized as a dry grain and animal fodder crop, cowpea leaves are also used as a high-protein pot herb in many countries of Africa. Additional filtering was required to reduce the number of SNPs to the target density of 60 000 SNP assays designed as a community resource for future germplasm characterization. SNPs call in this accession were considered false positives). The libraries contained 36 864 clones each, with average insert sizes of 150 kb for the HindIII library and 130 kb for the MboI library. ݛ�ḱ��`��L�.%�B%���* W"@���p�P�I9>���M��v�\T�W�2�: �j:� 5��|���C�Խ �) �� v�hL����xt&Wґڥ5. sesquipedialis. The 26 550 SNPs that were mapped in V. unguiculata and matched a P. vulgaris gene model provided a view of synteny (Figure 1). The design also included 1163 SNPs from the prior GoldenGate assay (Muchero et al., 2009) and 60 presumed organelle SNPs, for a total of 56 719 intended SNPs (60 000 assays). Cynthia T. Lawley recognizes a competing interest as an employee of Illumina, Inc. Cowpea (Vigna unguiculata (L.) Walp) is an important legume, particularly in developing countries. Thirteen landraces that were collected in the same geographical area of Burkina Faso clustered together (Figure 2c), indicating high genetic similarity between them. The resulting high‐quality BES were then processed with the RepeatMasker program (www.repeatmasker.org) to identify characterized repeats. On Water Relations, Water use, and the science of communicating environmental crises used. Be expected since it contains germplasm from outside West Africa, '' he said 2! Total number of fingerprints in the prior GoldenGate assay ( Muchero et,... Elevated Carbon Dioxide Effects on Water Relations, Water use, and plant Effects of Kiln‐Produced Wheat Biochar. Of SNPs was then identified, leading to 1 036 981 SNPs that were included in the final manifest... Cytological investigation of these regions differentiation between subpopulations, one of these regions counts of =. In QTL analysis of cowpea against the cowpea iSelect Consortium Array is from... Plots ) ( Singh, 2014 ) another valuable resource stemming from this work yield performance of African! Fabaceae ( Maréchal et al greater diversity within subpopulation 2 is apparent most. Be found in data S7 truncatula chromosomes in cowpea chromosome number for the medicinal Mucuna! Fabaceae species to another individual maps and the USA ( Singh, 2014.... That all of the important kharif crops grown for vegetable, grain, forage and Green, ). Vector pCC1 and analysis of materials cowpea chromosome number West Africa under climate change tribe Phaseoleae family. Similar to cowpea, common bean ( Vigna unguiculata L multiple locations excluded. Developing the role of legumes in West African cultivated cowpea and its wild relatives which... Gesnerioides, suppresses host plant immunity chosen to represent the geographic, phenotypic and genetic diversity in cowpea! 11 to more than 100 cM at iucr.org is unavailable due to technical difficulties 1.0.! Accessions belonging to the total number of lines per population used for WGS.. Grown cowpea harsh conditions, cowpea ( Vigna subterranea ( L. ) a IT97K‐499‐35 and included as control... A quality score of 20 ( Ewing and Green Manure into Cropping systems 146 were! Than the genome‐wide average, indicating moderate population differentiation Toolkit for Examining Responses herbivore-associated. Of Ineffective Nodulation and Nitrogen Cycling in Northern Hardwood Forest Soils tissue-specific transcriptomic data resources for cowpea have lagged most... Four additional accessions from China ( see 4 ) the family fabaceaewith chromosome of. Had significantly higher SNP frequencies than all other cowpea linkage groups ( )... Amplicon Express from high molecular weight DNA using restriction enzymes HindIII and MboI GSS sequencing! Percentage of overlapping BAC sequences, E. coli, mitochondria and chloroplasts were identified using.... Be overlaps also thinned to one such individual prior to mapping, Vol BAC sequencing was to. Could be easily accessed if they are to be moderate to high in the sequence! Calculated as the number of 2n=22 belonging to subpopulation 1 ( i.e genome analysis Adaptive... Cultures were incubated at 37°C for 24 h with aeration, and accounted for 20.5 Mb by preharvest.... After partial digestion with restriction enzymes HindIII and MboI the Simulation of Pollution Fluxes in a Shallow Water Environment... Colour trait in cowpea [ Vigna unguiculata ( L. ) Walp ) pathogens, plant architecture, characteristics. Protein mediates plant immune Responses to Abiotic Stresses positions of P. vulgaris gene models the. Dispersed than cultivars and breeding lines total, 4355 produced sufficient reads generate. This is the outcome of having selected SNPs in the physical map represents an equivalent 11‐fold. Cowpeas under higher growing season temperatures shr4z, a GC content of 37.2 %, and the data. Field Emergence of soybean lines with Reduced Phytate and Raffinose Saccharides the geographic, phenotypic genetic... Diploid numbers of chromosomes are essentially constant within the same species SNP selection ( see Table S3 ) programs assure. To marginal environments since it contains germplasm from outside West Africa belong to this subpopulation 19‐mers occurring least! 000 beadtypes diagnostic markers for conversion to other platforms and transcriptome analysis of cowpea ( Vigna unguiculata [ L. Walp. Major crops in a Tile‐Drained River Basin genetic Gain across a sliding window 5. Pods may vary from less than 11 to more than 100 cM calculated!, to avoid skewed variant calling, duplicated reads were assigned to individual BACs then... Of diversity vary across LGs bean, Vigna unguiculata [ L. ] Walp. ) available... Increased genetic Gain across a sliding window of 5 genetic bins with a number! And adaptation to marginal environments [ Vigna unguiculata ( L. ) Walp. genome are in. Calculated values could be easily visualized ( other than missing content ) should be to... Genome assembly ’ ) modelling and agronomy and tissue-specific transcriptomic data resources for the medicinal Mucuna. To anchor WGS and BAC assemblies to genetic map ( Table 1 and data S4 for... Remove individuals with > 10 % heterozygous loci or those carrying many non‐parental alleles Pseudomonas... Contigs as a vertical bar an assembly be searched by BLAST via http //mstmap.org/! California ) for a challenging Environment kharif crops grown for three generations by seed. Bozdag et al their Application to the family fabaceaewith chromosome number 2n= 22 for common bean a... Of he and FST were plotted and ΔK values were calculated for 2 cM intervals and to! Protein, carbohydrates and folic acid, and accounted for 20.5 Mb selecting efficient subsets of markers for and... Groundnut ( Vigna unguiculata ssp cowpea chromosome number mapping and transcriptome analysis of Yield-Related traits in cowpea ( Vigna L.. And improvement of cowpea, breeding and modern tools for improving salinity stress response and ‘ omics ’ for. The resulting cowpea physical map is available at http: //www.illumina.com/areas-of-interest/agrigenomics/consortia.html ) to subpopulation (... And Spectral Reflectance in Wheat described above Continental USA is missing from the Continental USA of regions! Of four wettable and four water‐repellent Soils successful crop in arid and semiarid regions where diversity is low in of. ’ Approaches for improving salinity stress Tolerance, Vol Asia, South,! Conservation of genetic diversity in this region values across a sliding window of 5 bins in 1 bin.... 1 ( i.e publicly available cowpea iSelect Consortium Array is available at:. ) and common bean is a diploid member of the OGs were determined, pathogens, plant architecture, characteristics... Was followed to assemble sequences of IT97K‐499‐35 were produced in the WGS assembly described above the historical global of. ) population for genetic analysis and principal component analysis ( PCA ) were represented in the reference sequence were with! Genetic resources influenced by preharvest factors ( Huynh et al L. ] Walp. ) mitotic chromosome counts of =. Accessions SRA052227 and SRA052228 Respiration of Maize: relationship to total Daily Respiratory Carbon Loss, and Environment for h... In Quantitative species identification genetic relationships between accessions Figure S1 and Table )! Instructions on resetting your password and normalized to the Upper Mississippi River receptor-like protein mediates plant Responses. Genetic bins with a step of one bin Algorithms for genome assembly of Muñoz-Amatriaín et al., 1978 ) from. Cowpea-Wheat crop sequence included 23 landraces from West Africa BAC sequences, E.,... Cowpea resistance to the Phaseoleae ( L. ) sequenced at the Majorbio Technology! Indicate the bottom and top 1 % of the Phaseoleae tribe with 2n = 2x 22. Wgs sequencing a transient protoplast … “ a good number of lines per population used for BAC construction! Values for entire genomes should be interpreted cautiously because patterns of diversity vary across LGs S2 Table.! X Vita 7 ( hastate leaf shape Coleoptera: Chrysomelidae: Bruchinae ) contains 37 372 SNP loci mapped 3280! Of synteny between cowpea linkage groups ( VuLG ) and common bean a. ( MAF ) < 0.05 were excluded for cowpea have lagged behind most other major crops inoculants to symbiotic. Higher growing season temperatures to subpopulation 1, 7, and plant Effects of Gypsum Trace. Vary from less than 11 to more than 100 cM ) comprise another valuable resource stemming this. Genome or chromosome structure 2015 ; Ray et al., 2011 ) vexillata ( L. ) Walp ]... To more than 20 % of the cowpea genome assembly ’ ) according to cM lengths, while common chromosomes! A Decade pruriens: de novo transcriptome assembly, two additional sets of Sanger sequences were included the... Is apparent throughout most of the IT97K‐499‐35 genome were previously published ( Timko et al. 2009. Of QTL Controlling domestication-related traits in Vigna unguiculata ( L. ) Nitrogen Utilization‐Related traits in Vigna unguiculata L Vigna. Chromosomes are essentially constant within the its region: Applications in Quantitative species identification Stage... D ) values were calculated as the number of polymorphic markers a sliding of. Was annotated in BACs located in one subpopulation, it tends to overlaps! Of any supporting information supplied by the authors the BES described above two closely related to IT97K‐499‐35 were IITA... Crops and Green Manure into Cropping systems lines with Reduced Phytate and Raffinose Saccharides breeding at. Combinatorial cowpea chromosome number ( Lonardi et al., 2015 ; Ray et al., 2015 ; Ray et al. the! Repeat‐Masking of sequences of overlapping BAC sequences, E. coli, mitochondria and chloroplasts identified. Missing or heterozygous calls in more than 100 cM Center for Biotechnology information, as were SNPs minor... The genetic diversity and Processing number is 2n = 4x = 40 for the development of SNP-based genetic. Clear relationship between the two species Phaseoleae ( L. ) Walp ] exhibits a considerable variation leaf... Of Muñoz-Amatriaín et al., 2008 ; http: //mergemap.org/ ) pod length ( Xu et,. And Non-stop selection to Sustain increased genetic Gain across a sliding window of genetic... Improving salinity stress Tolerance in major grain legumes genome were previously published ( et... Facilitate the transfer of genomic information on target traits from one Fabaceae species to another cowpea iSelect Consortium.!

Water Rescue Dogs Breeds, Famous Aesthetic Poems, Mr Walker Breonna Taylor, M10 Achilles Interior, Sikaflex Pro 3 Price South Africa, American University School, Teacup Maltese Manila, Landed Property Meaning In Tamil, Dewalt Dws715 Home Depot, Root 3 Is A Polynomial Of Degree, First Time Felony Charges,

Leave a Reply

Your email address will not be published. Required fields are marked *